Stem-loop sequence hsa-mir-3945

Accession

MI0016602

Description

Homo sapiens miR-3945 stem-loop

Stem-loop

gau     --ugca g g  -gg             gag     a  uaaa 
   guuga      c u ac   ggagggcauagga   gguug ua    a
   |||||      | | ||   |||||||||||||   ||||| ||    u
   uaacu      g g ug   ccuuucguauucu   ccgac au    g
uag     uaguag g g  aaa             ---     -  uaac 

Deep sequencing

4 reads, 4 experiments

Genome context

• Coordinates (GRCh37.p5): chr4: 185772167-185772264 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000361376 ; RP11-701P16.5-001; intron 1

  OTTHUMT00000361377 ; RP11-701P16.5-002; intron 1

  OTTHUMT00000361376 ; RP11-701P16.5-001; intron 1

  OTTHUMT00000361377 ; RP11-701P16.5-002; intron 1

  OTTHUMT00000361376 ; RP11-701P16.5-001; intron 1

  OTTHUMT00000361377 ; RP11-701P16.5-002; intron 1

  ENST00000511703 ; RP11-701P16.5-001; intron 1

  ENST00000510284 ; RP11-701P16.5-002; intron 1

  ENST00000511703 ; RP11-701P16.5-001; intron 1

  ENST00000510284 ; RP11-701P16.5-002; intron 1

  ENST00000511703 ; RP11-701P16.5-001; intron 1

  ENST00000510284 ; RP11-701P16.5-002; intron 1

Database links

• ENTREZGENE: 100500818;MIR3945

Mature sequence hsa-miR-3945

• Accession: MIMAT0018361
• Sequence: 23 - agggcauaggagaggguugauau - 45
• Deep sequencing: 2 reads, 2 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3945
  • MIRDB:hsa-miR-3945
  • RNA22-HSA:hsa-miR-3945
  • TARGETMINER:hsa-miR-3945

References

1. PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).