Stem-loop sequence hsa-mir-3940

Accession MI0016597
Description Homo sapiens miR-3940 stem-loop
Gene family MIPF0001599; mir-3940
Stem-loop 
gcuuauc     -aaa         ----         --      c     au 
       gagga    gaucgaggu    ggguugggg  cgggcu ugggg  u
       |||||    |||||||||    |||||||||  |||||| |||||   
       uuccu    uugguucca    cccgacccu  gcccga acucu  u
-ucuucc     cuca         uuca         ag      c     gg
Get sequence
Deep sequencing
36 reads, 13 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 6416421-6416522 [-]
sense
ENST00000424942 ; KHSRP-203; intron 13
ENST00000424942 ; KHSRP-203; intron 13
ENST00000201886 ; KHSRP-201; intron 14
ENST00000398148 ; KHSRP-202; intron 14
ENST00000201886 ; KHSRP-201; intron 14
ENST00000398148 ; KHSRP-202; intron 14
ENST00000398148 ; KHSRP-201; intron 14
Database links

Mature sequence hsa-miR-3940-5p

Accession MIMAT0019229
Sequence

23 -  

guggguuggggcgggcucug

 - 42

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence experimental; Solexa [2]
Predicted targets

Mature sequence hsa-miR-3940-3p

Accession MIMAT0018356
Previous IDs hsa-miR-3940
Sequence

57 -  

cagcccggaucccagcccacuu

 - 78

Get sequence
Deep sequencing 31 reads, 10 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).