Stem-loop sequence hsa-mir-3938

Accession MI0016594
Description Homo sapiens miR-3938 stem-loop
Gene family MIPF0001520; mir-3938
Stem-loop 
--a   -auu       c      ua a                     uuu 
   gga    uuuaacc gaucac  g uuaucuacaagggaauuuuuu   a
   |||    ||||||| ||||||  | |||||||||||||||||||||    
   ccu    agguugg cuggug  c aauagauguucccuuaaaaaa   a
gua   cggu       a      gc c                     uuu
Get sequence
Deep sequencing
7 reads, 6 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 55886520-55886622 [-]
sense
OTTHUMT00000350954 ; ERC2-006; intron 11
OTTHUMT00000350954 ; ERC2-006; intron 11
OTTHUMT00000350954 ; ERC2-006; intron 11
OTTHUMT00000350884 ; ERC2-001; intron 14
OTTHUMT00000350953 ; ERC2-005; intron 14
OTTHUMT00000350884 ; ERC2-001; intron 14
OTTHUMT00000350953 ; ERC2-005; intron 14
OTTHUMT00000350884 ; ERC2-001; intron 14
OTTHUMT00000350953 ; ERC2-005; intron 14
ENST00000492584 ; ERC2-006; intron 11
ENST00000492584 ; ERC2-006; intron 11
ENST00000492584 ; ERC2-006; intron 11
ENST00000288221 ; ERC2-001; intron 14
ENST00000460849 ; ERC2-005; intron 14
ENST00000288221 ; ERC2-001; intron 14
ENST00000460849 ; ERC2-005; intron 14
ENST00000288221 ; ERC2-001; intron 14
ENST00000460849 ; ERC2-005; intron 14
Database links

Mature sequence hsa-miR-3938

Accession MIMAT0018353
Sequence

59 -  

aauucccuuguagauaacccgg

 - 80

Get sequence
Deep sequencing 2 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).