|
miRBase |
|
Stem-loop sequence hsa-mir-3936 |
|||||
| Accession | MI0016592 | ||||
| Description | Homo sapiens miR-3936 stem-loop | ||||
| Stem-loop |
--a a uc a --ca g caaau ---- u ug u ag gcaucuguc gugucugcugua aucccu cc gugu u || | || ||||||||| |||||||||||| |||||| || |||| ac g uc cguagacag cguagacgguau ugggga gg cgca g acg - gu a ccca g ---au ucuu g |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3936 |
|
| Accession | MIMAT0018351 |
| Sequence |
66 - uaagggguguauggcagaugca - 87 |
| Deep sequencing | 10 reads, 4 experiments |
| Evidence | experimental; Solexa [1-3] |
| Predicted targets |
|
References |
|
| 1 | |
| 2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
| 3 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|