Stem-loop sequence hsa-mir-3935

Accession MI0016591
Description Homo sapiens miR-3935 stem-loop
Stem-loop 
ggau      -     cca --a   --a    a  g         ug     a 
    guguuc cuguc   g   agg   gcug ug uuguaucua  aaggu a
    |||||| |||||   |   |||   |||| || |||||||||  |||||  
    cguaag gacgg   c   ucc   cgac ac agcauagau  uuuua g
-auu      a     aaa gaa   cac    c  g         gu     c
Get sequence
Deep sequencing
6 reads, 4 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 56279432-56279535 [+]
sense
OTTHUMT00000434590 ; GNAO1-011; intron 1
OTTHUMT00000434578 ; GNAO1-008; intron 1
OTTHUMT00000434590 ; GNAO1-011; intron 1
OTTHUMT00000434578 ; GNAO1-008; intron 1
OTTHUMT00000256981 ; GNAO1-001; intron 2
OTTHUMT00000256982 ; GNAO1-002; intron 2
OTTHUMT00000256981 ; GNAO1-001; intron 2
OTTHUMT00000256982 ; GNAO1-002; intron 2
OTTHUMT00000434561 ; GNAO1-004; intron 2
OTTHUMT00000434562 ; GNAO1-005; intron 2
OTTHUMT00000256981 ; GNAO1-001; intron 2
OTTHUMT00000256982 ; GNAO1-002; intron 2
OTTHUMT00000434561 ; GNAO1-004; intron 2
OTTHUMT00000434562 ; GNAO1-005; intron 2
ENST00000562316 ; GNAO1-011; intron 1
ENST00000563440 ; GNAO1-008; intron 1
ENST00000562316 ; GNAO1-011; intron 1
ENST00000563440 ; GNAO1-008; intron 1
ENST00000262493 ; GNAO1-001; intron 2
ENST00000262494 ; GNAO1-002; intron 2
ENST00000262493 ; GNAO1-001; intron 2
ENST00000262494 ; GNAO1-002; intron 2
ENST00000563661 ; GNAO1-004; intron 2
ENST00000565363 ; GNAO1-005; intron 2
ENST00000262493 ; GNAO1-001; intron 2
ENST00000262494 ; GNAO1-002; intron 2
ENST00000563661 ; GNAO1-004; intron 2
ENST00000565363 ; GNAO1-005; intron 2
Database links

Mature sequence hsa-miR-3935

Accession MIMAT0018350
Sequence

58 -  

uguagauacgagcaccagccac

 - 79

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).