Stem-loop sequence gma-MIR396e

AccessionMI0016586 (change log)
DescriptionGlycine max miR396e stem-loop
Gene family MIPF0000047; MIR396
Literature search

25 open access papers mention gma-MIR396e
(144 sentences)

Stem-loop
        c          u       c     ugugaggcuucucuccaaugaagguu 
5' gugau uuccacagcu ucuugaa ugugu                          u
   ||||| |||||||||| ||||||| |||||                           
3' cacua aaggugucga agaacuu acacg                          a
        a          u       a     aguaucuuaaagaaaacguaucccau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 35037484-35037597 [-]
intergenic
Database links

Mature sequence gma-miR396e

Accession MIMAT0018345
Sequence

7 - 

uuccacagcuuucuugaacugu

 - 28

Get sequence
Evidence experimental; Illumina [1], 454 [2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).