Stem-loop sequence gma-MIR159d

AccessionMI0016581 (change log)
DescriptionGlycine max miR159d stem-loop
Gene family MIPF0000010; MIR159
Literature search

24 open access papers mention gma-MIR159d
(83 sentences)

Stem-loop
      ug   u     g     c      uc      uu     -  ucaaua 
5' ggg  aau gagcu cuuag uaugga  ccacag  cuacc ca      a
   |||  ||| ||||| ||||| ||||||  ||||||  ||||| ||       
3' ucc  uua uucga ggguc auaccu  gguguu  gaugg gu      g
      gu   c     g     u      uc      cu     u  uuucgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR159d

Accession MIMAT0018340
Sequence

11 - 

agcugcuuagcuauggauccc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).