Stem-loop sequence gma-MIR156g

AccessionMI0016580 (change log)
DescriptionGlycine max miR156g stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156g
(167 sentences)

Stem-loop
   ugaacaauaucu   ac   u                          --  a      c     a 
5'             uga  agu uguugacagaagauagagagcacagg  ug ucauac caaaa a
               |||  ||| ||||||||||||||||||||||||||  || |||||| |||||  
3'             acu  uca guaacugucuucuaucucucguguuu  ac agugug guuuu g
   ------------   cu   u                          ug  g      u     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 8868796-8868913 [-]
intergenic
Database links

Mature sequence gma-miR156g

Accession MIMAT0018339
Sequence

27 - 

acagaagauagagagcacag

 - 46

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2