Stem-loop sequence gma-MIR394b

AccessionMI0016577 (change log)
DescriptionGlycine max miR394b stem-loop
Gene family MIPF0000100; MIR394
Literature search

9 open access papers mention gma-MIR394b
(14 sentences)

Stem-loop
          gu   -      u c            -    - -u  -----u   u 
5' uaacaga  uua uuggca u uguccaccucca cuuc c  ac      cuc c
   |||||||  ||| |||||| | |||||||||||| |||| |  ||      ||| u
3' guugucu  agu aacugu a acggguggaggu gaag g  ug      gag c
          ug   c      c u            u    u cu  uacacc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 48784355-48784458 [+]
intergenic
Database links

Mature sequence gma-miR394b-5p

Accession MIMAT0022973
Sequence

13 - 

uuggcauucuguccaccucc

 - 32

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR394b-3p

Accession MIMAT0018336
Previous IDsgma-miR394b
Sequence

74 - 

aggugggcauacugucaacu

 - 93

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).