Stem-loop sequence gma-MIR169e

AccessionMI0016576 (change log)
DescriptionGlycine max miR169e stem-loop
Gene family MIPF0001058; MIR169_6
Literature search

23 open access papers mention gma-MIR169e
(101 sentences)

Stem-loop
         c    a a  u         gcuuu     c       a     c    uaauu 
5' gucuug auga g gg agagagagu     ugagc aaggaug cuugc ggcg     a
   |||||| |||| | || |||||||||     ||||| ||||||| ||||| ||||     c
3' cagaau uacu c cu uuucucucg     acuug uuccuac gagcg ccgu     g
         a    - a  -         uauuc     -       a     a    uaugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 14210033-14210152 [+]
intergenic
Database links

Mature sequence gma-miR169e

Accession MIMAT0018335
Sequence

34 - 

agccaaggaugacuugccgg

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).