Stem-loop sequence gma-MIR172f

AccessionMI0016574 (change log)
DescriptionGlycine max miR172f stem-loop
Gene family MIPF0000035; MIR172
Literature search

27 open access papers mention gma-MIR172f
(125 sentences)

Stem-loop
     g                     a   --g    -c  ag     --g   -  g  u   au  aa 
5' gc gauguagcaucaucaagauuc cau   caaa  gc  guggu   ggu gg ac gug  gc  u
   || ||||||||||||||||||||| |||   ||||  ||  |||||   ||| || || |||  ||  c
3' cg cuacgucguaguaguucuaag gug   guuu  ug  uaccg   cca cc ug cau  ug  u
     a                     a   aag    uc  ga     aaa   a  g  u   cg  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 26905395-26905527 [+]
intergenic
Database links

Mature sequence gma-miR172f

Accession MIMAT0018333
Sequence

109 - 

agaaucuugaugaugcugca

 - 128

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).