|
miRBase |
|
Stem-loop sequence gma-MIR4411 |
|||||
| Accession | MI0016572 | ||||
| Description | Glycine max miR4411 stem-loop | ||||
| Stem-loop |
----a uua c
cgacga auuaguuguaguaau a
|||||| ||||||||||||||| u
gcuguu uaaucaauguuauua g
ccaug --- a
|
||||
| Genome context |
|
||||
Mature sequence gma-miR4411 |
|
| Accession | MIMAT0018331 |
| Sequence |
32 - uuauuguaacuaauuugucggu - 53 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|