Stem-loop sequence gma-MIR4411

AccessionMI0016572 (change log)
DescriptionGlycine max miR4411 stem-loop
Literature search

1 open access papers mention gma-MIR4411
(2 sentences)

Stem-loop 
   ----a      uua               c 
5'      cgacga   auuaguuguaguaau a
        ||||||   ||||||||||||||| u
3'      gcuguu   uaaucaauguuauua g
   ccaug      ---               a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 12590615-12590670 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR4411
gma-MIR4411chr1: 12590615-12590670 [+]
gma-MIR10408chr1: 12590738-12590810 [-]
Database links

Mature sequence gma-miR4411

Accession MIMAT0018331
Sequence

32 -  

uuauuguaacuaauuugucggu

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).