Stem-loop sequence gma-MIR169d

AccessionMI0016571 (change log)
DescriptionGlycine max miR169d stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

24 open access papers mention gma-MIR169d
(109 sentences)

Stem-loop
   --   u         u          u     --     u   au 
5'   aga uaguggaug gagccaagga gacuu  gccgg ugu  a
     ||| ||||||||| |||||||||| |||||  ||||| |||   
3'   ucu aucauuuau cuugguucuu cugaa  uggcc acg  a
   au   u         u          c     uu     c   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 14186946-14187033 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR169d
gma-MIR169dchr15: 14186946-14187033 [+]
gma-MIR169pchr15: 14192081-14192178 [+]
Database links

Mature sequence gma-miR169d

Accession MIMAT0018330
Sequence

14 - 

ugagccaaggaugacuugccggu

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).