Stem-loop sequence gma-MIR167g

AccessionMI0016548 (change log)
DescriptionGlycine max miR167g stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

26 open access papers mention gma-MIR167g
(190 sentences)

Stem-loop
         u      u    g         ag      uu 
5' cagcag ugaagc gcca caugaucug  uuuacc  c
   |||||| |||||| |||| |||||||||  ||||||  u
3' guuguc acuucg cggu guacuagac  gaaugg  a
         c      u    -         aa      uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 39602156-39602233 [+]
intergenic
Database links

Mature sequence gma-miR167g

Accession MIMAT0018307
Sequence

8 - 

ugaagcugccagcaugaucuga

 - 29

Get sequence
Evidence experimental; Illumina [1], 454 [2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).