|
miRBase |
|
Stem-loop sequence gma-MIR482b |
|||||
| Accession | MI0016527 | ||||
| Description | Glycine max miR482b stem-loop | ||||
| Gene family | MIPF0000403; MIR482 | ||||
| Stem-loop |
-auu uc ag gguaugggggg gggaaggaaua caua c ||||||||||| ||||||||||| |||| a ccauacccucc cccuucuuuau guau a acau -c aa |
||||
| Genome context |
|
||||
Mature sequence gma-miR482b-5p |
|
| Accession | MIMAT0018286 |
| Previous IDs | gma-miR482b |
| Sequence |
3 - uauggggggauugggaaggaau - 24 |
| Evidence | experimental; Solexa [1,3], 454 [2] |
Mature sequence gma-miR482b-3p |
|
| Accession | MIMAT0020952 |
| Sequence |
48 - ucuucccuacaccucccauacc - 69 |
| Evidence | experimental; Solexa [3] |
References |
|
| 1 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
| 2 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
| 3 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|