Stem-loop sequence gma-MIR4368b

AccessionMI0016510 (change log)
DescriptionGlycine max miR4368b stem-loop
Gene family MIPF0001147; MIR4368
Literature search

1 open access papers mention gma-MIR4368b
(1 sentences)

Stem-loop
   c         a            a                        ---    g   aa   a    caca 
5'  aaggacggu cuuacguaagca cgucuuugaaaguucacaaacaaa   gacg ugc  gca cguc    a
    ||||||||| |||||||||||| ||||||||||||||||||||||||   |||| |||  ||| ||||     
3'  uuucugcca gaauguauucgu gcagaaacuuucaaguguuuguuu   cugc acg  cgu gcag    a
   u         c            c                        aug    a   aa   g    aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 39873834-39873978 [+]
intergenic
Database links

Mature sequence gma-miR4368b

Accession MIMAT0018269
Sequence

2 - 

aaggacgguacuuacguaagcaac

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).