Stem-loop sequence gma-MIR396d

AccessionMI0016503 (change log)
DescriptionGlycine max miR396d stem-loop
Gene family MIPF0000047; MIR396
Literature search

25 open access papers mention gma-MIR396d
(148 sentences)

Stem-loop
   -g      c                   a     uau  aucuuauaucucuc 
5'   gucaug uuuuccacagcuuucuuga cuucu   gc              c
     |||||| ||||||||||||||||||| |||||   ||              a
3'   cgguau agagggugucgaaagaacu gaaga   cg              c
   aa      a                   c     ucc  aauuuuacgaccuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 8782240-8782347 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR396d
gma-MIR396dchr17: 8782240-8782347 [-]
gma-MIR396ichr17: 8774041-8774175 [+]
Database links

Mature sequence gma-miR396d

Accession MIMAT0018262
Sequence

83 - 

aagaaagcugugggagaauauggc

 - 106

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).