Stem-loop sequence gma-MIR4357

AccessionMI0016490 (change log)
DescriptionGlycine max miR4357 stem-loop
Literature search

1 open access papers mention gma-MIR4357
(1 sentences)

Stem-loop
   --auu          aa         ccucaauuauucucaaaauaauuuuaagucaucgcaccucaaagugauugaacucgucgggu 
5'      aacuguacaa  cacaugacu                                                              u
        ||||||||||  |||||||||                                                               
3'      uuggcauguu  gugugcuga                                                              u
   gauac          -a         cauuuugggaaauuccugcugcuuaaucacacgcugcucauaacacuacccuagguggcacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 25716585-25716759 [-]
intergenic
Database links

Mature sequence gma-miR4357

Accession MIMAT0018249
Sequence

150 - 

cagucgugugauuguacgguucau

 - 173

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).