Stem-loop sequence gma-MIR4348a

AccessionMI0016478 (change log)
Previous IDsgma-MIR4348
DescriptionGlycine max miR4348a stem-loop
Gene family MIPF0001966; MIR4348
Literature search

1 open access papers mention gma-MIR4348a
(1 sentences)

Stem-loop 
   -                             a           a      aa  g  c  c        aucaa 
5'  auguguuaaacuuguaagauggugacauu ugaugguuaug auguaa  au ac uu uauauugg     g
    ||||||||||||||||||||||||||||| ||||||||||| ||||||  || || || ||||||||      
3'  uacauaguuugaacguucuacuacuguaa acuaucaauac uacauu  ua ug aa auguaacc     u
   a                             c           c      --  g  a  a        aacau
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 37311016-37311160 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR4348a
gma-MIR4348achr12: 37311016-37311160 [-]
gma-MIR5040chr12: 37310768-37310918 [-]
Database links

Mature sequence gma-miR4348a-5p

Accession MIMAT0018237
Previous IDsgma-miR4348
Sequence

8 -  

aaacuuguaagauggugacauu

 - 29

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence gma-miR4348a-3p

Accession MIMAT0037389
Sequence

110 -  

uaucacaaugucaucaucuug

 - 130

Get sequence
Evidence experimental; Illumina [3]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).
3
PMID:25747880 "Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean" Zhao M, Meyers BC, Cai C, Xu W, Ma J Plant Cell. 27:546-562(2015).