Stem-loop sequence tae-MIR398

AccessionMI0016466 (change log)
DescriptionTriticum aestivum miR398 stem-loop
Gene family MIPF0000107; MIR398
Literature search

22 open access papers mention tae-MIR398
(76 sentences)

Stem-loop
   auac       aa    u      u   a              ---    c  ac      a 
5'     gcgagga  uucc gcgggg cga cugggaacacaugg   gaua ga  cgcuug u
       |||||||  |||| |||||| ||| ||||||||||||||   |||| ||  |||||| u
3'     cgcuccu  gagg cgcccc gcu gacucuuguguacu   cuau cu  gcgagc g
   ----       cc    u      c   g              caa    u  ca      a 
Get sequence
Deep sequencing
2880031 reads, 1.17e+04 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
3B: 662632381-662632500 [+]
intergenic
3B: 663360015-663360134 [-]
intergenic
Database links

Mature sequence tae-miR398

Accession MIMAT0018225
Sequence

85 - 

uguguucucaggucgcccccg

 - 105

Get sequence
Deep sequencing551994 reads, 116 experiments
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).