Stem-loop sequence tae-MIR395b

Accession

MI0016464

Description

Triticum aestivum miR395b stem-loop

Gene family

MIPF0000016; MIR395

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Stem-loop

cu          -         u     uc              aga      cca   a  au 
  gaaguguuug ggggaacuc uggug  accaagcauuuagu   cauugg   cau uc  a
  |||||||||| ||||||||| |||||  ||||||||||||||   ||||||   ||| ||   
  cuucacgaac uuccuuggg accau  ugguuuguaagucg   guaacu   gua ag  a
--          g         u     uc              --g      -ac   g  ag 

Mature sequence tae-miR395b

• Accession: MIMAT0018223
• Sequence: 2 - ugaaguguuugggggaacuc - 21
• Evidence: not experimental

References

1. PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).