Stem-loop sequence hvu-MIR169

AccessionMI0016459 (change log)
DescriptionHordeum vulgare miR169 stem-loop
Literature search

9 open access papers mention hvu-MIR169
(29 sentences)

Stem-loop
   u   a           --     ----aagg      ug    a 
5'  aac cgccagaaaua  aagcc        augagu  ccug u
    ||| |||||||||||  |||||        ||||||  |||| c
3'  uug gugguuuuugu  uucgg        uacuca  ggac a
   u   a           cu     gauggagg      --    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR169

Accession MIMAT0018218
Sequence

17 - 

aagccaaggaugaguugccug

 - 37

Get sequence
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).