Stem-loop sequence hvu-MIR166a

Accession

MI0016455

Previous IDs

hvu-MIR166

Description

Hordeum vulgare miR166 stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

c    uu    a         cn  g     naaaga     ncuc    g   u 
 augg  gucg ggggaauga  cc ggucc      gagac    gcau gcg g
 ||||  |||| |||||||||  || |||||      |||||    |||| |||  
 uacc  cagu ccccuuacu  gg ccagg      cuuug    cgug ugc c
-    -u    a         uc  a     ------     ----    g   g 

Mature sequence hvu-miR166a

• Accession: MIMAT0018213
• Previous IDs: hvu-miR166
• Sequence: 70 - ucggaccaggcuucauucccc - 90
• Evidence: not experimental

References

1. PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).