Stem-loop sequence tae-MIR156

AccessionMI0016450 (change log)
DescriptionTriticum aestivum miR156 stem-loop
Gene family MIPF0000008; MIR156
Literature search

38 open access papers mention tae-MIR156
(317 sentences)

Stem-loop
   uccucucucucucucucucu   u     ccgucu      -uc        u    c     --c  c      -        -       c     g        -    a        a         a  a      guaaagagga  gau 
5'                     gcg gucga      gcugug   cgauggga cggu ggggg   ug ggugga ggguugau gauggug gaaug cugacaga agag gugagcac cagcggcag cu cgucug          cg   g
                       ||| |||||      ||||||   |||||||| |||| |||||   || |||||| |||||||| ||||||| ||||| |||||||| |||| |||||||| ||||||||| || ||||||          ||    
3'                     cgu cagcu      cgacgc   gcuacccu gccg ucccc   ac cuaccu ucuaacua cuaccgc cuugc gacugucu ucuc cacucgug guugucguc ga gcagau          gc   g
   -------------------c   -     ------      uuc        u    u     ucu  -      a        a       -     -        c    c        c         -  c      auagagagaa  gua 
Get sequence
Deep sequencing
189755 reads, 772 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR156

Accession MIMAT0018208
Sequence

96 - 

ugacagaagagagugagcaca

 - 116

Get sequence
Deep sequencing185880 reads, 116 experiments
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).