Stem-loop sequence tae-MIR156

AccessionMI0016450
DescriptionTriticum aestivum miR156 stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uccucucucucucucucucu   u     ccgucu      -uc        u    c     --c  c      -        -       c     g        -    a        a         a  a      guaaagagga  gau 
5'                     gcg gucga      gcugug   cgauggga cggu ggggg   ug ggugga ggguugau gauggug gaaug cugacaga agag gugagcac cagcggcag cu cgucug          cg   g
                       ||| |||||      ||||||   |||||||| |||| |||||   || |||||| |||||||| ||||||| ||||| |||||||| |||| |||||||| ||||||||| || ||||||          ||    
3'                     cgu cagcu      cgacgc   gcuacccu gccg ucccc   ac cuaccu ucuaacua cuaccgc cuugc gacugucu ucuc cacucgug guugucguc ga gcagau          gc   g
   -------------------c   -     ------      uuc        u    u     ucu  -      a        a       -     -        c    c        c         -  c      auagagagaa  gua 
Get sequence
Deep sequencing
616066 reads, 2.84e+05 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?

Mature sequence tae-miR156

Accession MIMAT0018208
Sequence

96 - 

ugacagaagagagugagcaca

 - 116

Get sequence
Deep sequencing481615 reads, 3 experiments
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).