Stem-loop sequence hvu-MIR156a

AccessionMI0016449 (change log)
Previous IDshvu-MIR156
DescriptionHordeum vulgare miR156 stem-loop
Gene family MIPF0000008; MIR156
Literature search

18 open access papers mention hvu-MIR156a
(162 sentences)

Stem-loop
   u      -    a        a         g  a     gauaa       -   a            a 
5'  gacaga agag gugagcac cagcggcag cu cgucu     gagcaug guu auaguauagcca c
    |||||| |||| |||||||| ||||||||| || |||||     ||||||| ||| |||||||||||| u
3'  cugucu ucuc cacucgug guugucguc ga gcaga     uucgugc cga uaucauaucggu g
   u      c    c        c         -  c     -----       a   g            c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR156a

Accession MIMAT0018207
Previous IDshvu-miR156
Sequence

1 - 

ugacagaagagagugagcaca

 - 21

Get sequence
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).