Stem-loop sequence dpu-mir-279b

AccessionMI0016447 (change log)
DescriptionDaphnia pulex miR-279b stem-loop
Literature search

1 open access papers mention dpu-mir-279b
(2 sentences)

Stem-loop
   aucuug  c     u  gu   -     -uc         ug    uuaaa 
5'       ag auacg ca  cgg cgagu   gguuuuagu  uauu     u
         || ||||| ||  ||| |||||   |||||||||  ||||      
3'       uc uaugu gu  gcc gcuca   ccaagauca  augg     u
   -cuuua  u     c  ug   u     cac         gu    cugau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (V1.0; GCA_000187875.1) Overlapping transcripts
GL732554.1: 68646-68746 [-]
intergenic
Database links

Mature sequence dpu-miR-279b

Accession MIMAT0018923
Sequence

61 - 

ugacuagaacccacacucguccgg

 - 84

Get sequence
Evidence not experimental

References

1
PMID:20702459 "A congruent solution to arthropod phylogeny: phylogenomics, microRNAs and morphology support monophyletic Mandibulata" Rota-Stabelli O, Campbell L, Brinkmann H, Edgecombe GD, Longhorn SJ, Peterson KJ, Pisani D, Philippe H, Telford MJ Proc Biol Sci. 278:298-306(2011).