Stem-loop sequence isc-mir-iab-4

AccessionMI0016445 (change log)
DescriptionIxodes scapularis miR-iab-4 stem-loop
Gene family MIPF0000151; mir-iab-4
Stem-loop
   ------g    -g   c c        -           u    -  u   ugu 
5'        auuc  cgg g cucccguu cguauacugag guau cc gag   u
          ||||  ||| | |||||||| ||||||||||| |||| || |||   u
3'        uaag  gcc c gggggcaa gcauaugacuu caua gg cuu   a
   aggcgcg    ag   - a        u           c    u  c   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence isc-miR-iab-4

Accession MIMAT0018921
Sequence

20 - 

ucguauacugaguguauccuga

 - 41

Get sequence
Evidence not experimental

References

1
PMID:20702459 "A congruent solution to arthropod phylogeny: phylogenomics, microRNAs and morphology support monophyletic Mandibulata" Rota-Stabelli O, Campbell L, Brinkmann H, Edgecombe GD, Longhorn SJ, Peterson KJ, Pisani D, Philippe H, Telford MJ Proc Biol Sci. 278:298-306(2011).