Stem-loop sequence isc-mir-276

AccessionMI0016443 (change log)
DescriptionIxodes scapularis miR-276 stem-loop
Gene family MIPF0000124; mir-276
Stem-loop
   aggggaa    - -     c       g    c    g     -   uga  g 
5'        gucg c gcuau gcgagcg ggua ggag ucuua cug   gc u
          |||| | ||||| ||||||| |||| |||| ||||| |||   || c
3'        cagc g cggua cgcucgu ccau cuuc aggau gac   cg a
   ---ugca    a a     u       a    a    a     c   ---  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS848078: 34710-34809 [-]
intergenic
Database links

Mature sequence isc-miR-276

Accession MIMAT0018919
Sequence

61 - 

uaggaacuucauaccaugcuc

 - 81

Get sequence
Evidence not experimental

References

1
PMID:20702459 "A congruent solution to arthropod phylogeny: phylogenomics, microRNAs and morphology support monophyletic Mandibulata" Rota-Stabelli O, Campbell L, Brinkmann H, Edgecombe GD, Longhorn SJ, Peterson KJ, Pisani D, Philippe H, Telford MJ Proc Biol Sci. 278:298-306(2011).