Stem-loop sequence hsa-mir-3926-2

Accession MI0016437
Description Homo sapiens miR-3926-2 stem-loop
Gene family MIPF0001118; mir-3926
Stem-loop 
                           gcu 
ggagcuggccaaaaagcaggcagagac   u
|||||||||||||||||||||||||||   u
ccucgaccgguuuuucguccgucucug   u
                           aaa
Get sequence
Deep sequencing
2 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 12584746-12584808 [+]
antisense
OTTHUMT00000384367 ; LONRF1-008; intron 2
OTTHUMT00000384367 ; LONRF1-008; intron 2
OTTHUMT00000384367 ; LONRF1-008; intron 2
OTTHUMT00000384364 ; LONRF1-004; intron 6
OTTHUMT00000384364 ; LONRF1-004; intron 6
OTTHUMT00000384364 ; LONRF1-004; intron 6
OTTHUMT00000251693 ; LONRF1-001; intron 10
OTTHUMT00000384365 ; LONRF1-002; intron 10
OTTHUMT00000384368 ; LONRF1-003; intron 10
OTTHUMT00000251693 ; LONRF1-001; intron 10
OTTHUMT00000384365 ; LONRF1-002; intron 10
OTTHUMT00000384368 ; LONRF1-003; intron 10
OTTHUMT00000251693 ; LONRF1-001; intron 10
OTTHUMT00000384365 ; LONRF1-002; intron 10
OTTHUMT00000384368 ; LONRF1-003; intron 10
ENST00000578598 ; MIR3926-2-201; exon 1
ENST00000525024 ; LONRF1-008; intron 2
ENST00000525024 ; LONRF1-008; intron 2
ENST00000525024 ; LONRF1-008; intron 2
ENST00000524526 ; LONRF1-004; intron 6
ENST00000524526 ; LONRF1-004; intron 6
ENST00000524526 ; LONRF1-004; intron 6
ENST00000398246 ; LONRF1-001; intron 10
ENST00000526680 ; LONRF1-002; intron 10
ENST00000533751 ; LONRF1-003; intron 10
ENST00000533751 ; LONRF1-003; intron 10
ENST00000398246 ; LONRF1-001; intron 10
ENST00000526680 ; LONRF1-002; intron 10
ENST00000398246 ; LONRF1-001; intron 10
ENST00000526680 ; LONRF1-002; intron 10
ENST00000533751 ; LONRF1-003; intron 10
Clustered miRNAs
< 10kb from hsa-mir-3926-2
hsa-mir-5692a-2 chr8: 12576641-12576699 [+]
hsa-mir-3926-1 chr8: 12584741-12584813 [-]
hsa-mir-3926-2 chr8: 12584746-12584808 [+]
Database links

Mature sequence hsa-miR-3926

Accession MIMAT0018201
Sequence

6 -  

uggccaaaaagcaggcagaga

 - 26

Get sequence
Deep sequencing 7 reads, 5 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).