Stem-loop sequence hsa-mir-676

Accession MI0016436
Description Homo sapiens miR-676 stem-loop
Gene family MIPF0000471; mir-676
Stem-loop 
   ug    uu      c     uu   gaauu 
gca  acuc  caaccu aggac  gca     a
|||  ||||  |||||| |||||  |||      
cgu  ugag  guugga uccug  cgu     a
   gu    uu      a     -u   aaggu
Get sequence
Deep sequencing
20 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 69242707-69242773 [+]
sense
OTTHUMT00000057047 ; EDA-001; intron 2
OTTHUMT00000057048 ; EDA-002; intron 2
OTTHUMT00000389124 ; EDA-008; intron 2
OTTHUMT00000057047 ; EDA-001; intron 2
OTTHUMT00000057048 ; EDA-002; intron 2
OTTHUMT00000389124 ; EDA-008; intron 2
OTTHUMT00000057047 ; EDA-001; intron 2
OTTHUMT00000057048 ; EDA-002; intron 2
OTTHUMT00000389124 ; EDA-008; intron 2
OTTHUMT00000358734 ; EDA-005; intron 3
OTTHUMT00000358734 ; EDA-005; intron 3
OTTHUMT00000358734 ; EDA-005; intron 3
ENST00000390702 ; AL158141.1-201; exon 1
ENST00000390702 ; MIR676-201; exon 1
ENST00000374552 ; EDA-002; intron 2
ENST00000524573 ; EDA-008; intron 2
ENST00000374553 ; EDA-001; intron 2
ENST00000374553 ; EDA-001; intron 2
ENST00000374552 ; EDA-002; intron 2
ENST00000524573 ; EDA-008; intron 2
ENST00000374553 ; EDA-001; intron 2
ENST00000374552 ; EDA-002; intron 2
ENST00000524573 ; EDA-008; intron 2
ENST00000503592 ; EDA-005; intron 3
ENST00000503592 ; EDA-005; intron 3
ENST00000503592 ; EDA-005; intron 3
Database links
  • ENTREZGENE: 100500887;MIR676

Mature sequence hsa-miR-676-5p

Accession MIMAT0018203
Previous IDs hsa-miR-676*
Sequence

8 -  

ucuucaaccucaggacuugca

 - 28

Get sequence
Deep sequencing 4 reads, 1 experiments
Evidence experimental; Solexa [1,3]
Predicted targets

Mature sequence hsa-miR-676-3p

Accession MIMAT0018204
Previous IDs hsa-miR-676
Sequence

43 -  

cuguccuaagguuguugaguu

 - 63

Get sequence
Deep sequencing 16 reads, 3 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).
3
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).