Stem-loop sequence hsa-mir-3925

Accession

MI0016433

Description

Homo sapiens miR-3925 stem-loop

Stem-loop

                        g     c   uca 
gugggaauagcaagagaacugaaa uggag cug   c
|||||||||||||||||||||||| ||||| |||   a
caccuuuaucguucucuugauuuu accuc gac   u
                        g     a   cuc 

Genome context

• Coordinates (GRCh37.p5): chr6: 36590213-36590289 [-]
• Overlapping transcripts:

  antisense

  ENST00000536757 ; PI16-201; intron 2

  ENST00000536757 ; PI16-201; intron 2

  ENST00000536757 ; PI16-201; intron 2

Database links

• ENTREZGENE: 100500885;MIR3925

Mature sequence hsa-miR-3925-5p

• Accession: MIMAT0018200
• Previous IDs: hsa-miR-3925
• Sequence: 12 - aagagaacugaaaguggagccu - 33
• Evidence: experimental; Solexa [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3925-5p
  • MIRDB:hsa-miR-3925-5p
  • RNA22-HSA:hsa-miR-3925-5p
  • TARGETMINER:hsa-miR-3925-5p

Mature sequence hsa-miR-3925-3p

• Accession: MIMAT0019228
• Sequence: 47 - acuccaguuuuaguucucuug - 67
• Evidence: experimental; Solexa [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3925-3p
  • MIRDB:hsa-miR-3925-3p
  • TARGETMINER:hsa-miR-3925-3p

References

1. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).