Stem-loop sequence hsa-mir-3922

Accession

MI0016429

Description

Homo sapiens miR-3922 stem-loop

Stem-loop

                                 cagg   g 
ggaagagucaagucaaggccagaggucccacag    gcu g
|||||||||||||||||||||||||||||||||    |||  
cuuucucaguucaguuccggucuucaggguguc    cga a
                                 caca   a 

Deep sequencing

5 reads, 3 experiments

Genome context

• Coordinates (GRCh37.p5): chr12: 104985411-104985494 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000406054 ; CHST11-007; intron 1

  OTTHUMT00000405959 ; CHST11-002; intron 1

  OTTHUMT00000405960 ; CHST11-001; intron 1

  OTTHUMT00000406056 ; CHST11-006; intron 1

  OTTHUMT00000406057 ; CHST11-005; intron 1

  OTTHUMT00000406054 ; CHST11-007; intron 1

  OTTHUMT00000405959 ; CHST11-002; intron 1

  OTTHUMT00000405960 ; CHST11-001; intron 1

  OTTHUMT00000406056 ; CHST11-006; intron 1

  OTTHUMT00000406057 ; CHST11-005; intron 1

  OTTHUMT00000406054 ; CHST11-007; intron 1

  OTTHUMT00000405959 ; CHST11-002; intron 1

  OTTHUMT00000405960 ; CHST11-001; intron 1

  OTTHUMT00000406056 ; CHST11-006; intron 1

  OTTHUMT00000406057 ; CHST11-005; intron 1

  ENST00000547956 ; CHST11-007; intron 1

  ENST00000549260 ; CHST11-002; intron 1

  ENST00000303694 ; CHST11-001; intron 1

  ENST00000546689 ; CHST11-006; intron 1

  ENST00000549016 ; CHST11-005; intron 1

  ENST00000547956 ; CHST11-007; intron 1

  ENST00000549260 ; CHST11-002; intron 1

  ENST00000303694 ; CHST11-001; intron 1

  ENST00000546689 ; CHST11-006; intron 1

  ENST00000549016 ; CHST11-005; intron 1

  ENST00000547956 ; CHST11-007; intron 1

  ENST00000549260 ; CHST11-002; intron 1

  ENST00000303694 ; CHST11-001; intron 1

  ENST00000546689 ; CHST11-006; intron 1

  ENST00000549016 ; CHST11-005; intron 1

Database links

• ENTREZGENE: 100500843;MIR3922

Mature sequence hsa-miR-3922-5p

• Accession: MIMAT0019227
• Sequence: 13 - ucaaggccagaggucccacagca - 35
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; Solexa [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3922-5p
  • MIRDB:hsa-miR-3922-5p
  • TARGETMINER:hsa-miR-3922-5p

Mature sequence hsa-miR-3922-3p

• Accession: MIMAT0018197
• Previous IDs: hsa-miR-3922
• Sequence: 62 - ucuggccuugacuugacucuuu - 83
• Deep sequencing: 2 reads, 1 experiments
• Evidence: experimental; Solexa [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3922-3p
  • MIRDB:hsa-miR-3922-3p
  • RNA22-HSA:hsa-miR-3922-3p
  • TARGETMINER:hsa-miR-3922-3p

References

1. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).