|
miRBase |
|
Stem-loop sequence hsa-mir-3150b |
||||||
| Accession | MI0016426 | |||||
| Description | Homo sapiens miR-3150b stem-loop | |||||
| Gene family | MIPF0001102; mir-3150 | |||||
| Stem-loop |
a g c - g gaggg aagcaggccaaccucga gaucucc cagc cuug c ||||| ||||||||||||||||| ||||||| |||| |||| g cuccc uucguccgguuggagcu cuagagg gucg ggac u c g a u u |
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence hsa-miR-3150b-5p |
|
| Accession | MIMAT0019226 |
| Sequence |
15 - caaccucgaggaucuccccagc - 36 |
| Evidence | experimental; Solexa [2-3] |
| Predicted targets |
|
Mature sequence hsa-miR-3150b-3p |
|
| Accession | MIMAT0018194 |
| Previous IDs | hsa-miR-3150b |
| Sequence |
53 - ugaggagaucgucgagguugg - 73 |
| Deep sequencing | 3 reads, 1 experiments |
| Evidence | experimental; Solexa [1-3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
| 2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
| 3 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|