Stem-loop sequence hsa-mir-3914-2

AccessionMI0016421 (change log)
Symbol HGNC:MIR3914-2
DescriptionHomo sapiens miR-3914-2 stem-loop
Gene family MIPF0001169; mir-3914
Literature search

1 open access papers mention hsa-mir-3914-2
(1 sentences)

     g   cuacuc                          cca   ua 
5' ga uuc      aacuucucauuuucugguuccuucua   agu  a
   || |||      ||||||||||||||||||||||||||   |||  g
3' cu aag      uugaagaguaaaagaccaaggaagau   uca  c
     g   ucuaaa                          uac   ua 
Get sequence
Deep sequencing
71 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 71307674-71307768 [+]
OTTHUMT00000320044 ; CALN1-004; intron 4
OTTHUMT00000345230 ; CALN1-007; intron 4
OTTHUMT00000320083 ; CALN1-006; intron 5
OTTHUMT00000252013 ; CALN1-005; intron 5
ENST00000405452 ; CALN1-201; intron 3
ENST00000329008 ; CALN1-004; intron 4
ENST00000431984 ; CALN1-007; intron 4
ENST00000412588 ; CALN1-202; intron 4
ENST00000395275 ; CALN1-006; intron 5
ENST00000395276 ; CALN1-005; intron 5
Clustered miRNAs
< 10kb from hsa-mir-3914-2
hsa-mir-3914-1chr7: 71307672-71307770 [-]
hsa-mir-3914-2chr7: 71307674-71307768 [+]
Database links

Mature sequence hsa-miR-3914

Accession MIMAT0018188

61 - 


 - 82

Get sequence
Deep sequencing65 reads, 27 experiments
Evidence experimental; Illumina [1-2]
Predicted targets


PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).