Stem-loop sequence hsa-mir-3914-1

Accession

MI0016419

Description

Homo sapiens miR-3914-1 stem-loop

Gene family

MIPF0001169; mir-3914

Stem-loop

    c   ag                              au    au 
ugga uuc  auuuaacuucucauuuucugguuccuucua  gagu  g
|||| |||  ||||||||||||||||||||||||||||||  ||||  c
aucu aag  ugaguugaagaguaaaagaccaaggaagau  uuca  u
    c   ga                              gg    au 

Deep sequencing

2 reads, 2 experiments

Genome context

• Coordinates (GRCh37.p5): chr7: 70772658-70772756 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000252006 ; WBSCR17-001; intron 1

  OTTHUMT00000345151 ; WBSCR17-003; intron 1

  OTTHUMT00000345152 ; WBSCR17-004; intron 1

  OTTHUMT00000345150 ; WBSCR17-002; intron 1

  OTTHUMT00000252006 ; WBSCR17-001; intron 1

  OTTHUMT00000345151 ; WBSCR17-003; intron 1

  OTTHUMT00000345152 ; WBSCR17-004; intron 1

  OTTHUMT00000345150 ; WBSCR17-002; intron 1

  OTTHUMT00000252006 ; WBSCR17-001; intron 1

  OTTHUMT00000345151 ; WBSCR17-003; intron 1

  OTTHUMT00000345152 ; WBSCR17-004; intron 1

  OTTHUMT00000345150 ; WBSCR17-002; intron 1

  ENST00000333538 ; WBSCR17-001; intron 1

  ENST00000498380 ; WBSCR17-003; intron 1

  ENST00000447516 ; WBSCR17-004; intron 1

  ENST00000467723 ; WBSCR17-002; intron 1

  ENST00000333538 ; WBSCR17-001; intron 1

  ENST00000498380 ; WBSCR17-003; intron 1

  ENST00000447516 ; WBSCR17-004; intron 1

  ENST00000467723 ; WBSCR17-002; intron 1

  ENST00000333538 ; WBSCR17-001; intron 1

  ENST00000498380 ; WBSCR17-003; intron 1

  ENST00000447516 ; WBSCR17-004; intron 1

  ENST00000467723 ; WBSCR17-002; intron 1

Clustered miRNAs

< 10kb from hsa-mir-3914-1

• hsa-mir-3914-2: chr7: 70772660-70772754 [+]
• hsa-mir-3914-1: chr7: 70772658-70772756 [-]

Database links

• ENTREZGENE: 100500836;MIR3914-1

Mature sequence hsa-miR-3914

• Accession: MIMAT0018188
• Sequence: 63 - aaggaaccagaaaaugagaagu - 84
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; Solexa [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3914
  • MIRDB:hsa-miR-3914
  • RNA22-HSA:hsa-miR-3914
  • TARGETMINER:hsa-miR-3914

References

1. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).