|
miRBase |
|
Stem-loop sequence hsa-mir-3911 |
|||||
| Accession | MI0016415 | ||||
| Description | Homo sapiens miR-3911 stem-loop | ||||
| Stem-loop |
a g u u cug - ag ac -agcuu g gggug ggau ug g ggauc gaggag gcag aag agug gcca u ||||| |||| || | ||||| |||||| |||| ||| |||| |||| cccac ucua ac c cuuag cucuuc cguc uuc ucac uggu u g g - - --- g cu cu aaccuu c |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3911 |
|
| Accession | MIMAT0018185 |
| Sequence |
12 - uguguggauccuggaggaggca - 33 |
| Deep sequencing | 5 reads, 2 experiments |
| Evidence | experimental; Solexa [1-2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
| 2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|