Stem-loop sequence hsa-mir-3909

Accession MI0016413
Description Homo sapiens miR-3909 stem-loop
Stem-loop 
   aug   u    c    -  -    c     -a        cg         gaaaagc 
ggu   cug ugcg uguc cu uccu ugggg  gcaggcuc  ggggacagg       a
|||   ||| |||| |||| || |||| |||||  ||||||||  |||||||||       c
cca   gac acgu acag ga aggg acucu  cguccggg  cuccuguuc       a
   --g   c    -    u  g    u     ga        au         aaggaac
Get sequence
Deep sequencing
103 reads, 16 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr22: 35731633-35731751 [+]
sense
OTTHUMT00000320655 ; TOM1-015; intron 6
OTTHUMT00000320655 ; TOM1-015; intron 6
OTTHUMT00000320655 ; TOM1-015; intron 6
OTTHUMT00000320642 ; TOM1-002; intron 10
OTTHUMT00000320642 ; TOM1-002; intron 10
OTTHUMT00000320642 ; TOM1-002; intron 10
OTTHUMT00000320641 ; TOM1-001; intron 11
OTTHUMT00000320646 ; TOM1-006; intron 11
OTTHUMT00000320641 ; TOM1-001; intron 11
OTTHUMT00000320646 ; TOM1-006; intron 11
OTTHUMT00000320641 ; TOM1-001; intron 11
OTTHUMT00000320646 ; TOM1-006; intron 11
OTTHUMT00000320643 ; TOM1-003; intron 13
OTTHUMT00000320643 ; TOM1-003; intron 13
OTTHUMT00000320643 ; TOM1-003; intron 13
ENST00000491987 ; TOM1-015; intron 6
ENST00000491987 ; TOM1-015; intron 6
ENST00000491987 ; TOM1-015; intron 6
ENST00000450839 ; TOM1-207; intron 9
ENST00000412456 ; TOM1-203; intron 9
ENST00000450839 ; TOM1-207; intron 9
ENST00000412456 ; TOM1-203; intron 9
ENST00000424387 ; TOM1-002; intron 10
ENST00000425375 ; TOM1-204; intron 10
ENST00000436462 ; TOM1-205; intron 10
ENST00000424387 ; TOM1-002; intron 10
ENST00000425375 ; TOM1-204; intron 10
ENST00000436462 ; TOM1-205; intron 10
ENST00000424387 ; TOM1-002; intron 10
ENST00000425375 ; TOM1-203; intron 10
ENST00000436462 ; TOM1-204; intron 10
ENST00000449058 ; TOM1-001; intron 11
ENST00000337040 ; TOM1-006; intron 11
ENST00000411850 ; TOM1-202; intron 11
ENST00000447733 ; TOM1-206; intron 11
ENST00000449058 ; TOM1-001; intron 11
ENST00000337040 ; TOM1-006; intron 11
ENST00000411850 ; TOM1-202; intron 11
ENST00000447733 ; TOM1-206; intron 11
ENST00000449058 ; TOM1-001; intron 11
ENST00000337040 ; TOM1-006; intron 11
ENST00000411850 ; TOM1-202; intron 11
ENST00000447733 ; TOM1-205; intron 11
ENST00000451197 ; TOM1-208; intron 12
ENST00000451197 ; TOM1-208; intron 12
ENST00000404284 ; TOM1-003; intron 13
ENST00000382034 ; TOM1-201; intron 13
ENST00000404284 ; TOM1-003; intron 13
ENST00000382034 ; TOM1-201; intron 13
ENST00000404284 ; TOM1-003; intron 13
ENST00000382034 ; TOM1-201; intron 13
Clustered miRNAs
< 10kb from hsa-mir-3909
hsa-mir-3909 chr22: 35731633-35731751 [+]
hsa-mir-6069 chr22: 35732714-35732792 [-]
Database links

Mature sequence hsa-miR-3909

Accession MIMAT0018183
Sequence

71 -  

uguccucuagggccugcagucu

 - 92

Get sequence
Deep sequencing 75 reads, 12 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).