Stem-loop sequence tca-mir-3901

AccessionMI0016401 (change log)
DescriptionTribolium castaneum miR-3901 stem-loop
Stem-loop
   cuuau   cu    -auu    uuu       c     uc        c     --uu    ua  u 
5'      gug  aagc    uuga   uaugagu aaaaa  uaauaaaa gauau    guaa  aa u
        |||  ||||    ||||   ||||||| |||||  |||||||| |||||    ||||  || g
3'      cac  uuug    aacu   auauuua uuuuu  auuauuuu uuaug    uauu  uu a
   uaaau   -u    cauu    -uu       c     -u        -     uuuc    gc  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 12320608-12320737 [-]
intergenic
Database links

Mature sequence tca-miR-3901-5p

Accession MIMAT0018906
Sequence

14 - 

cauuuugauuuuaugaguc

 - 32

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3901-3p

Accession MIMAT0018907
Sequence

100 - 

cauuuauauuucaauuacgu

 - 119

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).