Stem-loop sequence tca-mir-3898

AccessionMI0016398 (change log)
DescriptionTribolium castaneum miR-3898 stem-loop
Stem-loop
   gaccu     -uu  ugua    c      cauguu     a   g  -  c 
5'      ugcga   gc    ccgg ucauag      uaauu ucu cg cg u
        |||||   ||    |||| ||||||      ||||| ||| || ||  
3'      acguu   ug    ggcc aguauu      guuga aga gu gu a
   gacgu     cau  -uag    a      ---aau     -   g  a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 4106423-4106521 [+]
intergenic
Database links

Mature sequence tca-miR-3898-5p

Accession MIMAT0018900
Sequence

13 - 

gcuguaccggcucauagca

 - 31

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3898-3p

Accession MIMAT0018901
Sequence

72 - 

uaugaaccgggauguuacuu

 - 91

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).