Stem-loop sequence tca-mir-3897

AccessionMI0016397 (change log)
DescriptionTribolium castaneum miR-3897 stem-loop
Stem-loop
   caaaa     uacu                  g       - u 
5'      guguu    ucacucucgccuucgccg cauggcg c g
        |||||    |||||||||||||||||| ||||||| | a
3'      cgcgg    gguggggguggggguggu gugccgc g u
   -----     -cac                  g       c g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG4: 554633-554714 [-]
intergenic
Database links

Mature sequence tca-miR-3897-5p

Accession MIMAT0018898
Sequence

16 - 

cacucucgccuucgccggca

 - 35

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3897-3p

Accession MIMAT0018899
Sequence

52 - 

cgugguggugggggugggg

 - 70

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).