Stem-loop sequence tca-mir-3896

AccessionMI0016395 (change log)
DescriptionTribolium castaneum miR-3896 stem-loop
Stem-loop
   ccgau      -a    u  ag  aaa   c  - gacg g   --  u    a 
5'      uuugac  uauc cg  ug   uuc aa c    g cug  gg cucc a
        ||||||  |||| ||  ||   ||| || |    | |||  || ||||  
3'      aaacug  auag gc  ac   aag uu g    c gac  uc gagg c
   uuuuu      ga    -  aa  guc   a  a auca a   aa  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG8: 4771979-4772082 [+]
intergenic
Database links

Mature sequence tca-miR-3896-5p

Accession MIMAT0018894
Sequence

12 - 

auaucucgagugaaauucca

 - 31

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3896-3p

Accession MIMAT0018895
Sequence

77 - 

aacugcaaacggauaaggu

 - 95

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).