Stem-loop sequence tca-mir-3894

AccessionMI0016393 (change log)
DescriptionTribolium castaneum miR-3894 stem-loop
Stem-loop
   ugaaa        uu        ---uaa   ag   au   ua g 
5'      uuugcggu  uaauucca      ugc  acg  uuu  c a
        ||||||||  ||||||||      |||  |||  |||  |  
3'      aaauguua  auuaaggu      gcg  ugc  aag  g c
   aaaac        --        uauuug   ag   --   gc g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 9418908-9418994 [-]
intergenic
Database links

Mature sequence tca-miR-3894-5p

Accession MIMAT0018890
Sequence

11 - 

gguuuuaauuccauaaugca

 - 30

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3894-3p

Accession MIMAT0018891
Sequence

58 - 

gcgguuuauuggaauuaauu

 - 77

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).