Stem-loop sequence tca-mir-3893

AccessionMI0016392 (change log)
DescriptionTribolium castaneum miR-3893 stem-loop
Stem-loop
      uu     u   g       -          ca   aau 
5' ggu  uauuu ucc auguuac gacggcuuua  uga   u
   |||  ||||| ||| ||||||| ||||||||||  |||    
3' uca  auaaa agg ugcaaug cugucgaaau  acu   u
      uu     c   -       a          --   aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 7175554-7175633 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3893
tca-mir-9dChLG5: 7174040-7174132 [+]
tca-mir-2944bChLG5: 7174149-7174250 [+]
tca-mir-309aChLG5: 7174273-7174360 [+]
tca-mir-3893ChLG5: 7175554-7175633 [+]
tca-mir-309cChLG5: 7175649-7175737 [+]
tca-mir-309bChLG5: 7175766-7175855 [+]
tca-mir-3791ChLG5: 7175867-7175951 [+]
Database links

Mature sequence tca-miR-3893-5p

Accession MIMAT0018888
Sequence

13 - 

ccgauguuacgacggcuuuacauga

 - 37

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3893-3p

Accession MIMAT0018889
Sequence

48 - 

auaaagcugucaguaacguggac

 - 70

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).