Stem-loop sequence tca-mir-3892

AccessionMI0016390 (change log)
DescriptionTribolium castaneum miR-3892 stem-loop
Stem-loop
   auuuc    -a    ug   -   -aac      auuu 
5'      guua  cccc  gug gaa    ccauac    g
        ||||  ||||  ||| |||    ||||||     
3'      uaau  gggg  uac cuu    ggugug    u
   cuuaa    ac    gu   a   aauu      aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 14781729-14781803 [+]
intergenic
Database links

Mature sequence tca-miR-3892-5p

Accession MIMAT0018884
Sequence

9 - 

aaccccugguggaaaaccc

 - 27

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3892-3p

Accession MIMAT0018885
Sequence

40 - 

aagugugguuaauucacauugggggc

 - 65

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).