Stem-loop sequence tca-mir-3791

AccessionMI0016389 (change log)
DescriptionTribolium castaneum miR-3791 stem-loop
Stem-loop
   aucaa         uc         auua         cga 
5'      guuaaacgu  ggugguuuu    cggugguug   u
        |||||||||  |||||||||    |||||||||   u
3'      caauuugua  cuacuaaag    gccacuaac   u
   uaaac         cu         augg         auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 7175867-7175951 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3791
tca-mir-9dChLG5: 7174040-7174132 [+]
tca-mir-2944bChLG5: 7174149-7174250 [+]
tca-mir-309aChLG5: 7174273-7174360 [+]
tca-mir-3893ChLG5: 7175554-7175633 [+]
tca-mir-309cChLG5: 7175649-7175737 [+]
tca-mir-309bChLG5: 7175766-7175855 [+]
tca-mir-3791ChLG5: 7175867-7175951 [+]
Database links

Mature sequence tca-miR-3791-5p

Accession MIMAT0018882
Sequence

16 - 

cggugguuuuauuacggugguugcg

 - 40

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3791-3p

Accession MIMAT0018883
Sequence

51 - 

ucaccggguagaaaucaucu

 - 70

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).