Stem-loop sequence tca-mir-3891

AccessionMI0016388 (change log)
DescriptionTribolium castaneum miR-3891 stem-loop
Stem-loop
   uc  -a     --a     uaa  ug cg aaa    -uuacug    a 
5'   gg  gaugc   gaggu   ug  u  u   acac       uaau a
     ||  |||||   |||||   ||  |  |   ||||       ||||  
3'   cc  cuacg   cucca   au  g  g   ugug       auug a
   -a  aa     cca     uaa  gu au ---    uaaaaua    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 3317398-3317489 [-]
intergenic
Database links

Mature sequence tca-miR-3891-5p

Accession MIMAT0018880
Sequence

10 - 

cagagguuaaugugucguaaa

 - 30

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3891-3p

Accession MIMAT0018881
Sequence

66 - 

aguguaaauaccucaccgc

 - 84

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).