Stem-loop sequence tca-mir-3889

AccessionMI0016386 (change log)
DescriptionTribolium castaneum miR-3889 stem-loop
Stem-loop
   uguaa        c     -     u     uc           u ga 
5'      uaaacuca aaaau gcgac uguuc  ucuguauugug g  g
        |||||||| ||||| ||||| |||||  ||||||||||| |   
3'      auuugagu uuuug cgcug acaag  aggcaugauac c  u
   uucgc        -     u     c     uu           u gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 15203725-15203820 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3889
tca-mir-3889ChLG3: 15203725-15203820 [+]
tca-mir-3841ChLG3: 15203860-15203954 [+]
tca-mir-3840ChLG3: 15203983-15204073 [+]
tca-mir-9cChLG3: 15204096-15204202 [+]
tca-mir-2944aChLG3: 15204224-15204312 [+]
tca-mir-279cChLG3: 15204345-15204456 [+]
tca-mir-3843ChLG3: 15204456-15204547 [+]
Database links

Mature sequence tca-miR-3889-5p

Accession MIMAT0018876
Sequence

23 - 

acuuguucucucuguauugugug

 - 45

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3889-3p

Accession MIMAT0018877
Sequence

56 - 

uaguacggauugaacacgucgc

 - 77

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).