Stem-loop sequence tca-mir-3886

AccessionMI0016383 (change log)
DescriptionTribolium castaneum miR-3886 stem-loop
Stem-loop
   uacaa   -  a  -  gcuu    a        gg  g  g 
5'      cuc ac gc ga    ugac ggugauga  gu gu a
        ||| || || ||    |||| ||||||||  || ||  
3'      ggg ug ug cu    auug cuauuauu  cg ua g
   ggcga   a  g  a  auau    g        ag  g  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLGX: 3178840-3178923 [+]
intergenic
Database links

Mature sequence tca-miR-3886-5p

Accession MIMAT0018870
Sequence

7 - 

ucacagcgagcuuugacag

 - 25

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3886-3p

Accession MIMAT0018871
Sequence

55 - 

uaucgguuauauaucagugg

 - 74

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).