Stem-loop sequence tca-mir-3884

AccessionMI0016381 (change log)
DescriptionTribolium castaneum miR-3884 stem-loop
Stem-loop
   aaaac   a    ac   uu  cug     uac 
5'      uga gcug  gag  aa   ccggg   u
        ||| ||||  |||  ||   |||||    
3'      acu cgac  cuu  uu   ggccc   u
   gaaga   c    cc   uu  --a     uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped1515: 1844-1909 [+]
intergenic
Database links

Mature sequence tca-miR-3884-5p

Accession MIMAT0018866
Sequence

4 - 

acugaagcugacgaguuaacugccgg

 - 29

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3884-3p

Accession MIMAT0018867
Sequence

38 - 

ucccggauuuuuuccccagccucaa

 - 62

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).