Stem-loop sequence tca-mir-980

AccessionMI0016380 (change log)
DescriptionTribolium castaneum miR-980 stem-loop
Gene family MIPF0000890; mir-980
Stem-loop
   uugac   ug g     cag     g   ug        a  g   g 
5'      aac  g ugccg   ggcuc uca  ggguagcu gc ugu a
        |||  | |||||   ||||| |||  |||||||| || ||| u
3'      uug  u acggu   ucggg agu  uccgucga cg aca u
   auuuu   gu -     aua     a   uu        c  -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped977: 1409-1503 [+]
intergenic
Database links

Mature sequence tca-miR-980-5p

Accession MIMAT0018864
Sequence

20 - 

gggcucgucaugggguagc

 - 38

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-980-3p

Accession MIMAT0018865
Sequence

57 - 

cagcugccuuuugaagggcuau

 - 78

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).